Инициация репликации у дрожжей Saccharomyces cerevisiae
создание документов онлайн
Документы и бланки онлайн

Обследовать

Администрация
Механический Электроника
биологии ботаника
география
дом в саду
история
литература
маркетинг
математике
медицина
музыка
образование
психология
разное
художественная культура
экономика





















































Инициация репликации у дрожжей Saccharomyces cerevisiae

биологии



Отправить его в другом документе Tab для Yahoo книги - конечно, эссе, очерк Hits: 1019



дтхзйе дплхнеофщ

Закон онтогенетического старения и обновления, или закон Кренке
Методы молекулярной биологии
Особенности строение ДНК вирусов, бактерий, митохондрий
Центральная догма молекулярной биологии
Адаптивная регуляция у прокариот. Теория оперона. Lac-оперон. Индукция ферментов катаболизма нафталина
Электронная микроскопия
ДНК хроматина
Клеточные оболочки бактерий
Общая схема работы ядрышка как специального локуса синтеза рибосом
Секреция белков и образование мембран у бактерий
 

Инициация репликации у дрожжей Saccharomyces cerevisiae

1. Области начала репликации (ОНР) ARS и комплекс узнавания ОНР (ORC)

У S. cerevisiae были идентифицированы специфические элементы хромосомной ДНК, названные автономно реплицирующимися последовательностями ARS (autonomously replicating sequences). Встраивание этих элементов в кольцевые плазмидные ДНК обеспечивает автономную репликацию плазмид в клетках дрожжей. С использованием метода двумерного гель-электрофореза, позволяющего обнаружить 151e41db репликативные пузырьки ДНК, было показано, что элементы ARS совпадают с сайтами начала двунаправленной репликации ДНК как в содержащих ARS плазмидах, так и в самих дрожжевых хромосомах. Таким образом, последовательности ARS являются функциональными ОНР хромосомной ДНК S. cerevisiae. Эти свойства дрожжевых ОНР значительно облегчили их изучение.



В 16 хромосомах S. cerevisiae содержатся от 250 до 400 ОНР. Все изученные элементы ARS у дрожжей, имеющие модульную структуру, состоят из доменов А и В и имеют длину 100-150 п.н. (рис. 3.5). Домен А содержит консенсусную последовательность, названную ACS (ARS consensus sequence). Элемент ACS длиной 11 п.н. имеет первичную последовательность (A/T)TTTA(T/C)(A/G)TTT(A/T), являющуюся существенной для инициации репликации. Даже одиночные замены нуклеотидов в ACS могут устранить активность ARS. Тем не менее, некоторые известные ARS, содержащие одну и даже две измененные пары нуклеотидов по сравнению с ACS, являются эффективными ОНР. С другой стороны, не каждая последовательность ACS в геноме проявляет активность ОНР в отсутствие других доменов ARS.

Домен В в ARS состоит из 3 элементов. Ближайший к ACS элемент В1 образует вместе с ACS сайт связывания белкового комплекса узнавания ОНР. Богатый остатками А и Т элемент В2 выполняет функцию элемента расплетания ДНК DUE. Репликация ДНК в прототипной хромосомной ОНР ARS1 инициируется примерно посередине между сегментами В1 и В2. Элемент В3 в некоторых ARS связывает фактор транскрипции Abf1 и играет роль вспомогательного элемента AUX, обеспечивающего оптимальную эффективность инициации репликации. Элементы доменов В в различных элементах ARS у дрожжей гораздо менеее консервативны, чем домен А. Наиболее консервативным из них является элемент В1.

В прототипный элемент ARS1 иногда включают и третий домен С, расположенный по другую сторону от ACS и упакованный в уникально позиционированную нуклеосому. Эта нуклеосома, вероятно, понижает вероятность упаковки смежного сайта ACS в другую нуклеосому, которая могла бы подавить активность ARS1.

C последовательностью ACS и смежным сегментом В1 в дрожжевых ARS на протяжении почти всего клеточного цикла связан белковый комплекс узнавания ori (ORC – origin recognition complex). Общее количество  комплексов ORC в одной клетке примерно соответствует числу ARS. Этот комплекс состоит из 6 белков, кодируемых существенными генами ORC1-ORC6. Аналогичные комплексы ORC имеются у всех эукариотов (табл. 4.1). Три субъединицы комплекса (Orc1, Orc4 и Orc5) содержат сайты связывания нуклеотидов, как у ДНК-зависимых АТФаз, и относятся к семейству АТФаз ААА+. Самая большая субъединица Orc1 может гидролизовать АТФ in vitro, но в присутствии ДНК ARS гидролиз АТФ предотвращается. По-видимому, как и в случае белка DnaA, связанный АТФ играет в ORC роль аллостерического эффектора, требующегося для специфической ассоциации с последовательностями ДНК ARS, а гидролиз АТФ идет на более поздних стадиях инициации репликации.

AAATTTCGAAAAATGCT AAGAAATAGGTTAGTACTGAGTAGT

              B3

ATTTATTTAAGTATT GTTTGTGCACTTGCCTG CAAGGGCCTTTT

            B2

GAAAAGCAAGCAT AAAAGATC TAAACATAAAA TCTGTAAAATAACA

            B1                                                 ACS               

               сайт связывания комплекса ORC

Рис. 3.5. Организация прототипной области начала репликации ARS1

S. cerevisiae.

Изогнутыми стрелками отмечены сайты инициации двунаправленной репликации хромосомной ДНК. Приведена последовательность комплементарной нити сайта ACS

Таблица 3.1

Сравнение субъединиц комплекса ORC из разных эукариотов

Cубъединица ORC

Мол. масса (кД)

Консерватизм*

S. cere-

visiae

Drosophila

Xenopus

Идентич-

ность (%)

Гомология

(%)

1

120

115

115

22

33

2

72

82

74

23

35

3

62

79

63

18

30




4

56

47

50

27

39

5

53

42

46

23

38

6

50

30

40

14

23

* - Приведены средние значения идентичности и гомологии между белками S. cerevisiae, дрозофилы и человека

Связанный с ДНК комплекс ORC защищает участок ДНК длиной около 50 п.н. Для связывания с ARS требуется координированное действие 5 из 6 субъединиц ОRС и не нужна лишь самая маленькая субъединица Orc6. Предварительные данные об архитектуре комплекса ORC на ДНК ARS получены с использованием сшивки химическими агентами и УФ-светом. Показано, что субъединицы Orc1, Orc2 и Orc4 взаимодействуют только с верхней нитью последовательности ACS в большой канавке ДНК, а субъединица Orc5 контактирует со смежным элементом В1 (рис. 00). Такая асимметрия связывания с нитями ДНК характерна и для многих других белков, участвующих в инициации репликации. Комплекс ORC может рассматриваться как  белок-инициатор – аналог DnaA. Однако он занимает ОНР во время клеточного цикла постоянно, а не только в фазе S. Очевидно, что простого связывания ORC с ОНР недостаточно для инициации репликации. Комплекс ORC играет лишь роль “посадочной площадки” на ДНК, необходимой для последовательной вербовки на ДНК других компонентов аппарата инициации репликации.

Рис. 3.6. Архитектура комплекса ORC c ДНК ARS.

1-6 – субъединицы Orc1-Orc6. Двусторонними стрелками изображены взаимодействия белков Orc друг с другом и с основаниями элементов ACS и В1области начала репликации ARS

2. Этапы пути инициации репликации на ОНР у дрожжей

В конце митоза или в начале фазы G1 клеточного цикла нуклеопротеиновые комплексы ORC-ARS вербуют на ДНК белок Cdc6 c мол. массой 58 кД. Этот белок очень нестабилен и должен синтезироваться de novo после выхода клеток из митоза. Он имеет несколько доменов гомологии с субъединицами Orc1, Orc4 и Orc5 комплекса ORC и взаимодействует с ним. Кроме того, Cdc6 гомологичен белкам g-комплекса бактериальной ДНК-полимеразы III и эукариотического комплекса RFC – многосубъединичным ферментам, катализирующим зависящую от гидролиза АТФ погрузку на ДНК скользящих зажимов ДНК-полимераз. Подобно этим ферментам класса АТФаз ААА+, белок Cdc6 способен связывать и медленно гидролизовать АТФ in vitro. Консервативный домен связывания нуклеотидов в Cdc6 необходим для функционального взаимодействия с ORC-ARS in vivo. По аналогии с погрузчиками факторов процессивности, считается, что Cdc6 является погрузчиком на хроматин кольцевого комплекса MCM – ДНК-геликазы репликативных вилок, концентрация которой в клетках дрожжей в 10-100 раз больше концентрации ORC. Белок Cdc6 преимущественно взаимодействует в ORC с комплексом Orc1-АТФ. После узнавания ORC белком Cdc6, связавшим АТФ, образуется комплекс ARS-ORC-Cdc6, который, используя катализируемый Cdc6 гидролиз АТФ, привлекает к ОНР белки Mcm2-Mcm7. В этом процессе у S. cerevisiae участвует также не гомологичный субъединицам гексамера МСМ белок Mcm10, взаимодействующий с Mcm7. Отметим также, что связанный с ORC белок Cdc6 cпособствует ассоциации фактора транскрипции Abf1 c элементом В3 в ARS.

Погрузка геликазы МСМ на ORC-ARS в начале фазы G1 завершает образование “предрепликативного комплекса”, в котором ОНР получила “лицензию на репликацию” и перешла в компенентное для инициации состояние. Однако “запуск” (firing) репликации на уже готовой к инициации ОНР откладывается до фазы S клеточного цикла. Для такого запуска необходимо действие циклин-зависимых протеинкиназ, которые появляются только в начале этой фазы. К ним относятся комплексы главной киназы Cdc28 c циклинами типа В (Clb5 и Clb6) и киназы Cdc7 c её регуляторным циклиноподобным белком Dbf4. Циклины Clb5 и Clb6 синтезируются уже в фазе G1 и ассоциируются с Cdc28, но эти комплексы остаются неактивными до начала фазы S, когда их ингибитор Sic1 фосфорилируется под действием комплексов Cdc28 с циклинами фазы G1 и подвергается зависящему от убиквитина протеолизу. Белок Dbf4 очень нестабилен в течение всего клеточного цикла, особенно в начале фазы G1, когда его период полураспада равен 5 мин. Однако в начале фазы S его уровень и активность протеинкиназы Cdc7-Dbf4 достигают максимума. Таким образом, оба типа протеинкиназ становятся активными почти одновременно. Однако в активации ими ОНР проявляется определенная иерархия: Cdc7-Dbf4 действует после Cdc28-Clb.

Одним из субстратов для Cdc28-Clb является белок Cdc6, который сыграл свою роль после погрузки комплекса МСМ. Этот белок после фосфорилирования покидает комплекс с ORC и подвергается протеолитической деградации. В освобождении связанного Cdc6 может играть роль гидролиз АТФ, связанного с белком Orc1. На освободившееся место вербуется новый важный компонент инициации репликации – белок Cdc45, который взаимодействует с белками МСМ. Для включения Cdc45 в предрепликативный комплекс требуется действие киназы Cdc7-Dbf4, которая связывается с белками МСМ и вызывает их фосфорилирование. Белки Mcm2-4 и Mcm6-7 являются субстратами для этой киназы in vitro. Фосфорилирование МСМ под действием Cdc7-Dbf4 сопровождается повышением чувствительности ДНК в области В2 ARS1 к KMnO4, взаимодействующему с онДНК. Это показало, что Cdc7-Dbf4 запускает переход ДНК геликазы МСМ в активное состояние (см. 2.1) и вызывает локальное расплетание ДНК в богатом А:Т  сегменте ОНР. Связывание Cdc45 и модификация MCM приводят к образованию “преинициирующего комплекса”. В этот комплекс привлекаются также связывающий онДНК белок RPA и ДНК-полимераза a - праймаза. Вербовка этих белков критически зависит от присутствия в преинициирующем комплексе белка Cdc45, который может физически взаимодействовать с ними. В частности, белок Cdc45 связывается с субъединицей р70 комплекса Pola-праймаза (рис. 00). Киназа Cdc7-Dbf4 способна фосфорилировать и такие компоненты репликативного комплекса, как ДНК-полимераза a. Вербовка Pola-праймазы является первым этапом образования репликативных вилок на ARS.

            Рис. 3.7. Этапы пути инициации репликации ДНК у дрожжей

Рис. 3.8. Схема участия белков МСМ, ДНК-полимеразы a - праймазы и белков Cdc45 и

RPA в инициации репликации на эукариотической области ori

            После образования двунаправленных репликативных вилок геликаза МСМ и белок Cdc45 выходят из контакта с комплексом ORC и перемещаются вместе с репликативной ДНК-полимеразой. На ДНК ARS остается только пострепликативный комплекс, содержащий ORC – как и в начале пути инициации репликации. Такие комплексы существуют в течение митоза и ранней фазы G1 на копиях ARS в обеих дочерних хромосомах.